choosebank(), will return the list of available databases.
Then, you can use query to make your query and get a list of sequence names.
Remote access to ACNUC databases works by opening a socket connection on a port (for example
on port number 5558 at pbil.univ-lyon1.fr) and by communicating on this socket following the protocol
described in the section references.choosebank(bank = NA, host = "pbil.univ-lyon1.fr", port = 5558, server = FALSE,
blocking = TRUE, open = "a+", encoding = "", verbose = FALSE,
timeout = 5, infobank = FALSE, tagbank = NA)choosebank will return the names of all database known by the server.socketConnection)socketConnection)socketConnection)socketConnection)socketConnection)socketConnection)socketConnection. Default 5 seconds.infobank is TRUE and bank is NA, a data.frame
with all database informations will be returnedbank is NA and tagbank is documented, the names
of special purposes databases are returned. Current allowed values are TP
for frozen databases (TP is an acronym for "trasocketchoosebank() returns a list of all the databases names known
by the server, as a vector of string. When called with choosebank(infobank = TRUE), a data.frame
with more information is returned.citation("seqinr")where.is.this.acc if you have a sequence accession number but you
don't know which database to open, query to make a query when a database
is opened, connection, socketConnection# Need internet connection
# Show available databases:
choosebank()
# Show frozen databases:
choosebank(tag = "TP")
# Select a database:
choosebank("emblTP", tag = "TP")
# Do something with the database:
myseq <- gfrag("LMFLCHR36", start = 1, length = 30)
stopifnot(myseq == "cgcgtgctggcggcaatgaagcgttcgatg")
# Close the database:
closebank()Run the code above in your browser using DataLab