Last chance! 50% off unlimited learning
Sale ends in
The Trinucleotide-based Cross Covariance Descriptor
extrDNATCC(x, index = c("Dnase I", "Nucleosome"), nlag = 2,
customprops = NULL, normaliztion = FALSE)the input data, which should be a list or file type.
the physicochemical indices, it should be a list and there are 12 different physicochemical indices (Table 2), which the users can choose.
an integer larger than or equal to 0 and less than or equal to L-2 (L means the length of the shortest DNA sequence in the dataset). It represents the distance between two dinucleotides.
the users can use their own indices to generate the feature vector. It should be a dict, the key is dinucleotide (string), and its corresponding value is a list type.
with this option, the final feature vector will be normalized based on the total occurrences of all kmers. Therefore, the elements in the feature vectors represent the frequencies of kmers. The default value of this parameter is False.
A vector
This function calculates the trinucleotide-based cross covariance Descriptor
See extrDNATAC and extrDNATACC
# NOT RUN {
x = 'GACTGAACTGCACTTTGGTTTCATATTATTTGCTC'
extrDNATCC(x)
# }
Run the code above in your browser using DataLab