
These functions may be used, e.g., to find the indexes (positions) where
there is a match to some pattern.
The functions stri_locate_all_*
locate all the matches.
stri_locate_first_*
and stri_locate_last_*
give the first or the last matches, respectively.
stri_locate_all(str, ..., regex, fixed, coll, charclass)stri_locate_first(str, ..., regex, fixed, coll, charclass)
stri_locate_last(str, ..., regex, fixed, coll, charclass)
stri_locate(str, ..., regex, fixed, coll, charclass, mode = c("first",
"all", "last"))
stri_locate_all_charclass(str, pattern, merge = TRUE,
omit_no_match = FALSE)
stri_locate_first_charclass(str, pattern)
stri_locate_last_charclass(str, pattern)
stri_locate_all_coll(str, pattern, omit_no_match = FALSE, ...,
opts_collator = NULL)
stri_locate_first_coll(str, pattern, ..., opts_collator = NULL)
stri_locate_last_coll(str, pattern, ..., opts_collator = NULL)
stri_locate_all_regex(str, pattern, omit_no_match = FALSE, ...,
opts_regex = NULL)
stri_locate_first_regex(str, pattern, ..., opts_regex = NULL)
stri_locate_last_regex(str, pattern, ..., opts_regex = NULL)
stri_locate_all_fixed(str, pattern, omit_no_match = FALSE, ...,
opts_fixed = NULL)
stri_locate_first_fixed(str, pattern, ..., opts_fixed = NULL)
stri_locate_last_fixed(str, pattern, ..., opts_fixed = NULL)
character vector; strings to search in
supplementary arguments passed to the underlying functions,
including additional settings for opts_collator
, opts_regex
,
opts_fixed
, and so on
single string;
one of: "first"
(the default), "all"
, "last"
character vector; search patterns; for more details refer to stringi-search
single logical value;
indicates whether consecutive sequences of indexes in the resulting
matrix should be merged; stri_locate_all_charclass
only
single logical value; if FALSE
,
then two missing values will indicate that there was no match;
stri_locate_all_*
only
a named list used to tune up
the search engine's settings; see
stri_opts_collator
, stri_opts_fixed
,
and stri_opts_regex
, respectively; NULL
for the defaults
For stri_locate_all_*
,
a list of integer matrices is returned. Each list element
represents the results of a separate search scenario.
The first column gives the start positions
of the matches, and the second column gives the end positions.
Moreover, you may get two NA
s in one row
for no match (if omit_no_match
is FALSE
)
or NA
arguments.
stri_locate_first_*
and stri_locate_last_*
return an integer matrix with
two columns, giving the start and end positions of the first
or the last matches, respectively, and two NA
s if and
only if they are not found.
For stri_locate_*_regex
, if the match is of zero length,
end
will be one character less than start
.
Vectorized over str
and pattern
.
The matches may be extracted by calling
the stri_sub
function.
Alternatively, you may call stri_extract
directly.
stri_locate
, stri_locate_all
, stri_locate_first
,
and stri_locate_last
are convenience functions.
They just call stri_locate_*_*
, depending on the arguments used.
Other search_locate: stri_locate_all_boundaries
,
stringi-search
Other indexing: stri_locate_all_boundaries
,
stri_sub
# NOT RUN {
stri_locate_all('XaaaaX',
regex=c('\\p{Ll}', '\\p{Ll}+', '\\p{Ll}{2,3}', '\\p{Ll}{2,3}?'))
stri_locate_all('Bartolini', fixed='i')
stri_locate_all('a b c', charclass='\\p{Zs}') # all white spaces
stri_locate_all_charclass(c('AbcdeFgHijK', 'abc', 'ABC'), '\\p{Ll}')
stri_locate_all_charclass(c('AbcdeFgHijK', 'abc', 'ABC'), '\\p{Ll}', merge=FALSE)
stri_locate_first_charclass('AaBbCc', '\\p{Ll}')
stri_locate_last_charclass('AaBbCc', '\\p{Ll}')
stri_locate_all_coll(c('AaaaaaaA', 'AAAA'), 'a')
stri_locate_first_coll(c('Yy\u00FD', 'AAA'), 'y', strength=2, locale="sk_SK")
stri_locate_last_coll(c('Yy\u00FD', 'AAA'), 'y', strength=1, locale="sk_SK")
pat <- stri_paste("\u0635\u0644\u0649 \u0627\u0644\u0644\u0647 ",
"\u0639\u0644\u064a\u0647 \u0648\u0633\u0644\u0645XYZ")
stri_locate_last_coll("\ufdfa\ufdfa\ufdfaXYZ", pat, strength = 1)
stri_locate_all_fixed(c('AaaaaaaA', 'AAAA'), 'a')
stri_locate_all_fixed(c('AaaaaaaA', 'AAAA'), 'a', case_insensitive=TRUE, overlap=TRUE)
stri_locate_first_fixed(c('AaaaaaaA', 'aaa', 'AAA'), 'a')
stri_locate_last_fixed(c('AaaaaaaA', 'aaa', 'AAA'), 'a')
#first row is 1-2 like in locate_first
stri_locate_all_fixed('bbbbb', 'bb')
stri_locate_first_fixed('bbbbb', 'bb')
# but last row is 3-4, unlike in locate_last,
# keep this in mind [overlapping pattern match OK]!
stri_locate_last_fixed('bbbbb', 'bb')
stri_locate_all_regex('XaaaaX',
c('\\p{Ll}', '\\p{Ll}+', '\\p{Ll}{2,3}', '\\p{Ll}{2,3}?'))
stri_locate_first_regex('XaaaaX',
c('\\p{Ll}', '\\p{Ll}+', '\\p{Ll}{2,3}', '\\p{Ll}{2,3}?'))
stri_locate_last_regex('XaaaaX',
c('\\p{Ll}', '\\p{Ll}+', '\\p{Ll}{2,3}', '\\p{Ll}{2,3}?'))
# Use regex positive-lookahead to locate overlapping pattern matches:
stri_locate_all_regex("ACAGAGACTTTAGATAGAGAAGA", "(?=AGA)")
# note that start > end here (match of 0 length)
# }
Run the code above in your browser using DataLab