stri_match_all: Extract Regex Pattern Matches, Together with Capture Groups

Description

These functions extract substrings in str that match a given regex pattern. Additionally, they extract matches to every capture group, i.e., to all the sub-patterns given in round parentheses.

Usage

stri_match_all(str, ..., regex)
stri_match_first(str, ..., regex)
stri_match_last(str, ..., regex)
stri_match(str, ..., regex, mode = c("first", "all", "last"))
stri_match_all_regex(str, pattern, omit_no_match = FALSE,
  cg_missing = NA_character_, ..., opts_regex = NULL)
stri_match_first_regex(str, pattern, cg_missing = NA_character_, ...,
  opts_regex = NULL)
stri_match_last_regex(str, pattern, cg_missing = NA_character_, ...,
  opts_regex = NULL)

Arguments

str

character vector; strings to search in

...

supplementary arguments passed to the underlying functions, including additional settings for opts_regex

mode

single string; one of: "first" (the default), "all", "last"

pattern, regex

character vector; search patterns; for more details refer to stringi-search

omit_no_match

single logical value; if FALSE, then a row with missing values will indicate that there was no match; stri_match_all_* only

cg_missing

single string to be used if a capture group match is unavailable

opts_regex

a named list with ICU Regex settings, see stri_opts_regex; NULL for default settings

Value

For stri_match_all*, a list of character matrices is returned. Each list element represents the results of a different search scenario.

For stri_match_first* and stri_match_last* a character matrix is returned. Each row corresponds to a different search result.

The first matrix column gives the whole match. The second one corresponds to the first capture group, the third -- the second capture group, and so on.

Details

Vectorized over str and pattern.

If no pattern match is detected and omit_no_match=FALSE, then NAs are included in the resulting matrix (matrices), see Examples.

Please note: ICU regex engine currently does not fully support named capture groups.

stri_match, stri_match_all, stri_match_first, and stri_match_last are convenience functions. They just call stri_match_*_regex and were provided for consistency with other string searching functions' wrappers, see, among others, stri_extract.

Examples

Run this code

# NOT RUN {
stri_match_all_regex("breakfast=eggs, lunch=pizza, dessert=icecream",
   "(\\w+)=(\\w+)")
stri_match_all_regex(c("breakfast=eggs", "lunch=pizza", "no food here"),
   "(\\w+)=(\\w+)")
stri_match_all_regex(c("breakfast=eggs;lunch=pizza",
   "breakfast=bacon;lunch=spaghetti", "no food here"),
   "(\\w+)=(\\w+)")
stri_match_first_regex(c("breakfast=eggs;lunch=pizza",
   "breakfast=bacon;lunch=spaghetti", "no food here"),
   "(\\w+)=(\\w+)")
stri_match_last_regex(c("breakfast=eggs;lunch=pizza",
   "breakfast=bacon;lunch=spaghetti", "no food here"),
   "(\\w+)=(\\w+)")

stri_match_first_regex(c("abcd", ":abcd", ":abcd:"), "^(:)?([^:]*)(:)?$")
stri_match_first_regex(c("abcd", ":abcd", ":abcd:"), "^(:)?([^:]*)(:)?$", cg_missing="")

# Match all the pattern of the form XYX, including overlapping matches:
stri_match_all_regex("ACAGAGACTTTAGATAGAGAAGA", "(?=(([ACGT])[ACGT]\\2))")[[1]][,2]
# Compare the above to:
stri_extract_all_regex("ACAGAGACTTTAGATAGAGAAGA", "([ACGT])[ACGT]\\1")

# }

Run the code above in your browser using DataLab

Get 50% off unlimited learning