Learn R Programming

stringi (version 1.7.3)

stri_match_all: Extract Regex Pattern Matches, Together with Capture Groups

Description

These functions extract substrings in str that match a given regex pattern. Additionally, they extract matches to every capture group, i.e., to all the sub-patterns given in round parentheses.

Usage

stri_match_all(str, ..., regex)

stri_match_first(str, ..., regex)

stri_match_last(str, ..., regex)

stri_match(str, ..., regex, mode = c("first", "all", "last"))

stri_match_all_regex( str, pattern, omit_no_match = FALSE, cg_missing = NA_character_, ..., opts_regex = NULL )

stri_match_first_regex( str, pattern, cg_missing = NA_character_, ..., opts_regex = NULL )

stri_match_last_regex( str, pattern, cg_missing = NA_character_, ..., opts_regex = NULL )

Arguments

str

character vector; strings to search in

...

supplementary arguments passed to the underlying functions, including additional settings for opts_regex

mode

single string; one of: 'first' (the default), 'all', 'last'

pattern, regex

character vector; search patterns; for more details refer to stringi-search

omit_no_match

single logical value; if FALSE, then a row with missing values will indicate that there was no match; stri_match_all_* only

cg_missing

single string to be used if a capture group match is unavailable

opts_regex

a named list with ICU Regex settings, see stri_opts_regex; NULL for default settings

Value

For stri_match_all*, a list of character matrices is returned. Each list element represents the results of a different search scenario.

For stri_match_first* and stri_match_last* a character matrix is returned. Each row corresponds to a different search result.

The first matrix column gives the whole match. The second one corresponds to the first capture group, the third -- the second capture group, and so on.

If regular expressions feature a named capture group, the matrix columns will be named accordingly. However, for stri_match_first* and stri_match_last* this will only be the case if there is a single pattern.

Details

Vectorized over str and pattern (with recycling of the elements in the shorter vector if necessary). This allows to, for instance, search for one pattern in each given string, search for each pattern in one given string, and search for the i-th pattern within the i-th string.

If no pattern match is detected and omit_no_match=FALSE, then NAs are included in the resulting matrix (matrices), see Examples.

stri_match, stri_match_all, stri_match_first, and stri_match_last are convenience functions. They merely call stri_match_*_regex and are provided for consistency with other string searching functions' wrappers, see, among others, stri_extract.

See Also

The official online manual of stringi at https://stringi.gagolewski.com/

Other search_extract: about_search, stri_extract_all_boundaries(), stri_extract_all()

Examples

Run this code
# NOT RUN {
stri_match_all_regex('breakfast=eggs, lunch=pizza, dessert=icecream',
   '(\\w+)=(\\w+)')
stri_match_all_regex(c('breakfast=eggs', 'lunch=pizza', 'no food here'),
   '(\\w+)=(\\w+)')
stri_match_all_regex(c('breakfast=eggs;lunch=pizza',
   'breakfast=bacon;lunch=spaghetti', 'no food here'),
   '(\\w+)=(\\w+)')
stri_match_all_regex(c('breakfast=eggs;lunch=pizza',
   'breakfast=bacon;lunch=spaghetti', 'no food here'),
   '(?<when>\\w+)=(?<what>\\w+)')  # named capture groups
stri_match_first_regex(c('breakfast=eggs;lunch=pizza',
   'breakfast=bacon;lunch=spaghetti', 'no food here'),
   '(\\w+)=(\\w+)')
stri_match_last_regex(c('breakfast=eggs;lunch=pizza',
   'breakfast=bacon;lunch=spaghetti', 'no food here'),
   '(\\w+)=(\\w+)')

stri_match_first_regex(c('abcd', ':abcd', ':abcd:'), '^(:)?([^:]*)(:)?$')
stri_match_first_regex(c('abcd', ':abcd', ':abcd:'), '^(:)?([^:]*)(:)?$', cg_missing='')

# Match all the pattern of the form XYX, including overlapping matches:
stri_match_all_regex('ACAGAGACTTTAGATAGAGAAGA', '(?=(([ACGT])[ACGT]\\2))')[[1]][,2]
# Compare the above to:
stri_extract_all_regex('ACAGAGACTTTAGATAGAGAAGA', '([ACGT])[ACGT]\\1')

# }

Run the code above in your browser using DataLab