50% off | Unlimited Data & AI Learning
Get 50% off unlimited learning

ExpGenetic (version 0.1.0)

P2_miRNA_count: Count table of miRNAs in P2 (P2: one of the parents).

Description

Count table of miRNAs in P2 species. The "P2" represents one of parents.

Arguments

Examples

Run this code
head(P2_miRNA_count)
#                sequence  Bnapus.1  Bnapus.2  Bnapus.3
#1  TTTGGATTGAAGGGAGCTCTA     29848     12094     10685
#2  TTAGATTCACGCACAAACTCG       986       571       456
#3  TGAAGCTGCCAGCATGATCTA      3152      1436      1091
#4 CTTTGTCTATCGTTTGGAAAAG      2449      1307      1116
#5  GATCATGTTCGCAGTTTCACC      1364       650       656
#6  TTTCCAAATGTAGACAAAGCA     11658      3914      4123

Run the code above in your browser using DataLab