Learn R Programming

MassArray (version 1.24.0)

ampliconPrediction: Amplicon prediction

Description

Function to predict amplicon fragmentation pattern and details for T&C reactions on the plus and minus strands

Usage

ampliconPrediction(sequence, lower.threshold = 1500, upper.threshold = 7000, fwd.tag = "AGGAAGAGAG", rev.tag = "AGCCTTCTCCC", plot = TRUE, table = TRUE, lwd = 1, cex = 1, multiple.conversion = FALSE)

Arguments

sequence
Nucleotide sequence input as a character string
lower.threshold
Lower limit (in Da) of usable mass window (default: 1500)
upper.threshold
Upper limit (in Da) of usable mass window (default: 7000)
fwd.tag
Nucleotide tag sequence 5' of the forward primer
rev.tag
T7-containing nucleotide tag sequence 5' of the reverse primer
plot
Logical specifying whether or not to display graphical representation of fragmentation profiles (default is TRUE)
table
Logical specifying whether or not to return tabular representation of fragmentation profiles (default is TRUE)
lwd
The line width used for fragmentation display, a positive number, defaulting to 1
cex
A numerical value (defaulting to 1) giving the amount by which plotting text and symbols should be magnified relative to the default
multiple.conversion
Logical value specifying whether or not to include multiple CGs on the same conversion control fragment where possible (default is FALSE).

Value

If table is TRUE, returns a list containing the following items:
summary
A summary matrix of logical values specifying whether or not each CG is assayable by a given combination of cleavage reaction and DNA strand
counts
A numerical tally of the quantity of CGs that are assayable by each assay

Details

Plotted fragmentation patterns contain a number of detailed features including: CG positions, molecular weight overlaps, conversion controls, fragment assayability, and more.

Note that the graphical output does not contain a built-in legend at this time, but the plot may be interepreted as follows: Putative fragmentation patterns are shown for T and C-cleavage reactions on both the plus and minus strands of an input amplicon, with the T-forward, T-reverse, C-forward, and C-reverse shown in descending order. CG dinucleotides (filled circles) are numbered and colored in blue. Other fragments are colored according to their ability to be assayed: fragment molecular weight outside the testable mass window (gray), fragment molecular weight overlapping with another fragment (red), fragment containing a potential conversion control (green), or fragment uniquely assayable but containing no CGs (black). Linked arrowheads denote molecular weight overlaps between multiple CG-containing fragments. Yellow highlights represent tagged or primer sequences, while lavender highlights denote user-specified "required" sites.

Examples

Run this code
ampliconPrediction("TGGAACACCCAGCAAAGATCAAGCAGGAAAGGGCGCACGCAGCCTTCGTTGCTAACCTCCTCTGGACTCTGGTACCCCAGGCACCGCGAATGCTCCCCACCTCAGCCCCCTGACCTTTACCATCGCTGAAGCGGGCGTCGCTGATGTCTGCGGCGAGCCTGCCGACCAGCCCAGCTGCCCAGAGGAGCAGCCAGGCAAGGGCGCTGGCAGCCAGGACGCCGGAGCCCGACGCCCGAGAGGGGCGCGCGGAGCAAGCTGCGGTCACGGGAGGAACCTGAGCACGCAGAGCGTACCCCCACCTTCCACGGTGACCCGGACAGAACGCTCCTTGCGCTCCCACCCTAGGACCCCCTGTAACTCCAGGTTCCTGAGA")

Run the code above in your browser using DataLab