SeedMatchR (version 1.1.1)

get_seed: Get the target seed sequence given a canonical seed name and input sequence

Description

Given a sequence greater than 8 bp oriented 5' -> 3' and a seed definition, this function will return an object containing seed-specific sequence information. Users can input a custom seed name, but must provide the start position (start.pos) and stop position (stop.pos) that define the range of the seed sequence.

Built-in options: mer8, mer7A1, mer7m8, mer6

Note: The seed definitions mer8 and mer7A1 force a U at position g1. This results in an A in the target sequence being searched.

Usage

get_seed(guide.seq, seed.name = "mer7m8", start.pos = 1, stop.pos = 8)

Value

An object with the entries:

• Guide: Input guide sequence. Input is expected to be RNA.

• Seed.Name: The seed name.

• Seed.Seq.RNA: The seed sequence as a RNAString

• Seed.Seq.DNA: The seed sequence as a DNAString

• Target.Seq: The target DNA sequence based on the reverse complement of the seed as a DNAString

Arguments

guide.seq

A character string greater than 8 bp and oriented 5'-> 3'.

seed.name

The seed name of interest. Options: mer8, mer7A1, mer7m8, mer6. If not in the default list, the start.pos and stop.pos arguments will be used to define the seed.

start.pos

The start position for a custom seed definition

stop.pos

The stop position for a custom seed definition

Examples

# Example Ttr from Schlegel et al. 2022
guide.seq = "UUAUAGAGCAAGAACACUGUUUU"

# Get seed match
seed.seq = get_seed(guide.seq, "mer7m8")