powered by
Plot the Guide Strand with different optional seeds
plot_seeds(guide.seq)
A msaggplot of the guide sequence in addition to the available seed sequences
Guide a.k.a anti-sense sequence oriented 5' > 3'. Sequence must be greater than 8 bp.
library(msa) # Ttr siRNA sequence guide.seq = "UUAUAGAGCAAGAACACUGUUUU" # generate seed plot plotted.seeds = plot_seeds(guide.seq)
Run the code above in your browser using DataLab