Learn R Programming

chipPCR (version 0.0.8-10)

C317.amp: qPCR Experiment for the Amplification of adk Using the Bio-Rad CFX96 thermo cycler

Description

A quantitative real-time PCR of adk was performed.

Usage

data("C317.amp")

Arguments

Format

A data frame with 40 observations on the following 97 variables. The first column ("Cycle") contains the number of cycles and consecutive columns contain the replicates ("A01" to "H12").

Source

Stefan Roediger, Claudia Deutschmann, Claudia Zelck (BTU Cottbus - Senftenberg)

Details

adk was amplified in the Bio-Rad CFX96. The change of fluorescence was simultaneously monitored (EvaGreen, Mao et al. 2007). The primer sequences for adk were taken from this study. gDNA: 28.43 ng/microL DNA concentration, 260/280 ratio= 1.96 adk fw: CTCAGGCTCAGTTCATCATGGA adk rv: AGTTTGCCAGCATCCATAATGTC PCR conditions: 10 minutes at 95 degrees Celsius 40 x 30 seconds at 95 degrees Celsius 45 seconds at 59 degrees Celsius 45 seconds at 68 degrees Celsius

References

A Highly Versatile Microscope Imaging Technology Platform for the Multiplex Real-Time Detection of Biomolecules and Autoimmune Antibodies. S. Roediger, P. Schierack, A. Boehm, J. Nitschke, I. Berger, U. Froemmel, C. Schmidt, M. Ruhland, I. Schimke, D. Roggenbuck, W. Lehmann and C. Schroeder. Advances in Biochemical Bioengineering/Biotechnology. 133:33--74, 2013. http://www.ncbi.nlm.nih.gov/pubmed/22437246 Mao, F., Leung, W.-Y., Xin, X., 2007. Characterization of EvaGreen and the implication of its physicochemical properties for qPCR applications. BMC Biotechnol. 7, 76.

Examples

Run this code
  data(C317.amp)
  str(C317.amp)
  

Run the code above in your browser using DataLab