Learn R Programming

disprose (version 0.1.6)

count_PhCh: Calculate physical and chemical properties

Description

Calculates GC-content, detects several nucleotides in a row, calculates minimum folding energy and melting temperature for oligonucleotide probes.

Usage

count_PhCh(
  probe.var,
  trim = FALSE,
  data,
  digits = 4,
  mc.cores = 1,
  MFE.files.dir = NULL,
  delete.MFE.files = FALSE,
  GCmin = 40,
  GCmax = 60,
  nucl.pattern = c("a", "t", "g", "c"),
  n.crit = 5,
  RNAfold.path,
  temperature = 40,
  MFEmin = -3,
  TD.params = NULL,
  TMmin = 55,
  TMmax = 60,
  verbose = TRUE,
  Na = 50,
  K = 0,
  Tris = 0,
  Mg = 0,
  dNTPs = 0
)

count_GC( probe.var, trim.gc = FALSE, GCmin = 40, GCmax = 60, mc.cores = 1, add.to.data = FALSE, data, digits = 4 )

count_REP( probe.var, trim.rep = FALSE, nucl.pattern = c("a", "t", "g", "c"), n.crit = 5, mc.cores = 1, add.to.data = FALSE, data )

count_MFE( probe.var, RNAfold.path, temperature = 40, trim.mfe = FALSE, MFEmin = -3, add.to.data = FALSE, data, MFE.files.dir = NULL, delete.MFE.files = FALSE, mc.cores = 1, digits = 4, verbose = TRUE )

count_TM( probe.var, TD.params = NULL, trim.tm = FALSE, TMmin = 55, TMmax = 60, add.to.data = FALSE, data, digits = 4, mc.cores = 1, verbose = TRUE, Na = 50, K = 0, Tris = 0, Mg = 0, dNTPs = 0 )

Arguments

probe.var

character; vector of nucleotide probes

trim, trim.gc, trim.rep, trim.mfe, trim.tm

logical; whether to select results that meet the criterion

digits

integer; number of decimal places to round the result

mc.cores

integer; number of processors for parallel computation (not supported on Windows)

MFE.files.dir

character; directory for RNAfold input and output files

delete.MFE.files

logical; delete RNAfold input and output files

GCmin, GCmax

numeric; minimum and maximum value of GC-content (percent, used if trim = TRUE)

nucl.pattern

character; vector of nucleotide pattern

n.crit

integer; minimal amount of nucleotide pattern's repeats in a row to detect

RNAfold.path

character; name and path to RNAfold executable file

temperature

numeric; folding design temperature

MFEmin

numeric; maximum value of folding energy (used if trim = TRUE)

TD.params

character; vector of length 4, contains designation for four tables with thermodynamic values (nn_table - thermodynamic NN values, tmm_table - thermodynamic values for terminal mismatches, imm_table - thermodynamic values for internal mismatches, de_table - thermodynamic values for dangling ends). See Tm_NN for details.

TMmin, TMmax

numeric; minimum and maximum value of melting temperature (used if trim = TRUE)

verbose

logical; show messages

Na

numeric; millimolar concentration of Na, default is 50 (used for count_TM function)

K

numeric; millimolar concentration of K, default is 0 (used for count_TM function)

Tris

numeric; millimolar concentration of Tris, default is 0 (used for count_TM function)

Mg

numeric; millimolar concentration of Mg, default is 0 (used for count_TM function)

dNTPs

numeric; millimolar concentration of dNTPs, default is 0 (used for count_TM function)

add.to.data, data

logical; add result vector to specified data frame (used unconditionally if trim = TRUE)

Value

If trim = FALSE, count_PhCh function returns data frame with GC-count (GC.percent), nucleotide repeats (repeats, TRUE/FALSE), minimum folding energy (MFE) and melting temperature (TM) columns. If trim = TRUE, count_PhCh function returns provided data frame with attached four columns and rows selected according to values GCmin, GCmax, n.crit, MFEmin, TMmin, TMmax.

If trim.gc= FALSE, count_GC function returns GC.percent vector or data with attached GC.percent column (when add.to.data = TRUE). If trim.gc = TRUE, count_GC function returns provided data frame with attached GC.percent column and rows selected according to GCmin, GCmax values.

If trim.rep = FALSE, count_REP function returns repeats vector (logical; TRUE/FALSE - there are/there are no nucleotide repeats) or data with attached repeats column (when add.to.data = TRUE). If trim.rep = TRUE, count_REP function returns provided data frame with attached repeats column and rows selected according to n.crit value.

If trim.mfe = FALSE, count_MFE function returns MFE vector or data with attached MFE column (when add.to.data = TRUE). If trim.mfe = TRUE, count_MFE function returns provided data frame with attached MFE column and rows selected according to MFEmin value.

If trim.tm = FALSE, count_TM function returns TM vector or data with attached TM column (when add.to.data = TRUE). If trim.tm = TRUE, count_TM function returns provided data frame with attached TM column and rows selected according to TMmin, TMmax values.

Functions

  • count_PhCh: Calculates GC.percent, detects several nucleotides in a row, calculates minimum folding energy and melting temperature

  • count_GC: Calculates GC-content (percent)

  • count_REP: Detects several nucleotides in a row

  • count_MFE: Calculates minimum folding energy

  • count_TM: Calculates melting temperature

Details

GC-content trimming selects results that are between GCmin and GCmax (inclusive). Nucleotides' amount trimming deletes probes that contain n.crit or more of same nucleotides (pattern) in a row. Minimum folding energy trimming selects results that are equal or more than MFEmin. Melting temperature trimming selects results that are between TMmin and TMmax (inclusive).

This function is using ViennaRNA service to count minimum folding energy. ViennaRNA Package (UNIX or Windows) must be installed. While counting MFE, working directory is set to MFE.files.dir and input and output files for ViennaRNA ("seq_in" and "seq_out") are created in the working directory.Afterwards the working directory is changed back to user's setting. If no MFE.files.dir exists it is created and is not deleted even if delete.MFE.files = TRUE.

Melting temperature is counted with Tm_NN function. Indication of thermodynamic values must be provided. By default they are: nn_table = "DNA_NN4", tmm_table = "DNA_TMM1", imm_table = "DNA_IMM1", de_table = "DNA_DE1".

References

Lorenz R., Stephan H.B., H<U+00F6>ner zu Siederdissen C. et al. (2011). ViennaRNA Package 2.0. Algorithms for Molecular Biology, 6, 1. https://almob.biomedcentral.com/articles/10.1186/1748-7188-6-26.

Examples

Run this code
# NOT RUN {
probes <- data.frame (ids = 1:3,  probes = c ("acacacacacaca", "aaaaagggggtttttccccc",
                                             "atgcgctagctcagc"))
probes <- count_GC (probe.var = probes$probes, trim.gc = FALSE, GCmin = 40, GCmax = 60,
                   add.to.data = TRUE, data = probes)

probes <- count_REP (probe.var = probes$probes, trim.rep = FALSE, n.crit = 5,
                    add.to.data = TRUE, data = probes)
# }
# NOT RUN {
# This function is using ViennaRNA service. ViennaRNA Package must be installed.
MFE.files.dir <- tempdir()
probes <- count_MFE (probe.var = probes$probes, RNAfold.path = "D:/Vienna/RNAfold.exe",
                    temperature = 40, trim.mfe = FALSE, MFEmin = 0,
                    MFE.files.dir = MFE.files.dir, delete.MFE.files = TRUE,
                    add.to.data = TRUE, data = probes, mc.cores = 1)
unlink (MFE.files.dir, recursive = TRUE)
# }
# NOT RUN {
probes <- count_TM (probe.var = probes$probes, TD.params = NULL, trim.tm = FALSE,
                   TMmin = 55, TMmax = 60, add.to.data = TRUE, data = probes,
                   digits = 4, mc.cores = 1)
# All in one command
# }
# NOT RUN {
# This function is using ViennaRNA service. ViennaRNA Package must be installed.
MFE.files.dir <- tempdir()
probes2 <- count_PhCh (probe.var = probes$probes, trim = FALSE,
                      nucl.pattern = c ("a", "t", "g", "c"), n.crit = 5,
                      MFE.files.dir = MFE.files.dir, delete.MFE.files = TRUE,
                      RNAfold.path = "D:/Vienna/RNAfold.exe", temperature = 40,
                      TD.params = NULL, digits = 3, mc.cores = 1,
                      data = probes)
unlink (MFE.files.dir, recursive = TRUE)
# }
# NOT RUN {
# }

Run the code above in your browser using DataLab