This function sends genomic sequences to the NCBI Blast service.
blastSeq(seq, n_blast=20, delay_req=10, delay_rid=60, email=NULL,
xmlFolder=NULL, logFolder=NULL, keepInMemory=FALSE,
database="refseq_genomes", verbose=TRUE, createLog=TRUE)An xml file that contains the the NCBI result.
The fasta sequence that should be blasted (String).
Amount of parallel blast requests, in case seq is a vector.
Seconds between the single Blast requests.
Seconds between the single result requests.
User email, required information from NCBI (String).
Path to the result folder.
Path to the log folder.
Logical, shall the results be kept in the memory.
The NCBI database to use.
Shall the program give extensive feedback.
Create log files, needed for continuing a crashed program.
Daniel Fischer
This function sends fasta sequences to the NCBI blast service. The defaults for the delays are required by NCBI and must not be smaller than the default values. Also, NCBI asks the user to provide an email address.
The input seq can be a vector of strings. In that case the sequences are one after another processed. The option n_blast
sets then the upper threshold of how many blast requests are send to the NCBI Blast service at a time and kept running there parallel.
It is here in the users obligation not to misuse the service with too many parallel requests.
The xmlFolder parameter specifies the folder to where the XML results will be stored. In case the folder does not exist, R will create it.
In case the option keepInMemory is set to TRUE the Blast results will be kept in memory, otherwise they will
be just written to the HDD. Especially if many sequences are send to the blast service it is recommended to drop the result from the memory,
meaning to set the option keepinMemory=FALSE. The option keepinMemory=TRUE is currently still under development and should not be
used.
If log files should be written (createLog=TRUE) a log path should be given in logPath. However, if a xmlPath is given and the
option createLog=TRUE is set, then the log folder will be automatically created in the parental folder of the xmlFolder and is
called logs.
if (FALSE) {
blastSeq("ACGTGCATCGACTAGCTACGACTACGACTATC", email="[email protected]")
}
Run the code above in your browser using DataLab