seqinr (version 4.2-16)

choosebank: To select a database structured under ACNUC and located on the web

Description

This function allows to select one of the databases structured under ACNUC and located on the web. Called without arguments, choosebank(), will return the list of available databases. Then, you can use query to make your query and get a list of sequence names. Remote access to ACNUC databases works by opening a socket connection on a port (for example on port number 5558 at pbil.univ-lyon1.fr) and by communicating on this socket following the protocol described in the section references.

Usage

choosebank(bank = NA, host = "pbil.univ-lyon1.fr", port = 5558, server = FALSE,
                    blocking = TRUE, open = "a+", encoding = "", verbose = FALSE,
                    timeout = 5, infobank = FALSE, tagbank = NA)

Arguments

bank

string. The name of the bank. If NA, choosebank will return the names of all database known by the server.

host

string. Host name for port (see socketConnection)

port

integer. The TCP port number (see socketConnection)

server

logical. Should the socket be a client or a server? (see socketConnection)

blocking

logical. (see socketConnection)

open

string. A description of how to open the connection (see socketConnection)

encoding

string. The name of the encoding to be used. (see socketConnection)

verbose

logical. If TRUE, verbose mode is on

timeout

integer. The timeout in seconds for socketConnection. Default 5 seconds.

infobank

logical. If infobank is TRUE and bank is NA, a data.frame with all database informations will be returned

tagbank

string. If bank is NA and tagbank is documented, the names of special purposes databases are returned. Current allowed values are TP for frozen databases (TP is an acronym for "travaux pratiques" which means practicals in french, these databases are useful mainly for teaching so as to have stable results), TEST for test databases, and DEV for databases under development (unstable).

Value

When called with a regular bank name, an (invisible) list with 6 components:

socket

an object of class socket

bankname

the name of the bank

banktype

the type of the bank (GENBANK, EMBL, SWISSPROT, NBRF)

totseqs

the total number of sequences present in the opened database

totspecs

the total number of species present in the opened database

totkeys

the total number of keywords present in the opened database

When called with bank = NA:
names

A vector of all available bank names.

When called with bank = NA and infobank = TRUE, a data.frame with three columns:

bank

The name of the bank.

status

The bank status (on/of).

info

Short description of bank with last release date.

Details

When called without arguments, choosebank() returns a list of all the databases names known by the server, as a vector of string. When called with choosebank(infobank = TRUE), a data.frame with more information is returned.

References

For more information about the socket communication protocol with ACNUC please get at http://doua.prabi.fr/databases/acnuc/remote_acnuc.html. To get the release date and content of all the databases located at the pbil, please look at the following url: http://doua.prabi.fr/search/releases Gouy, M., Milleret, F., Mugnier, C., Jacobzone, M., Gautier,C. (1984) ACNUC: a nucleic acid sequence data base and analysis system. Nucl. Acids Res., 12:121-127. Gouy, M., Gautier, C., Attimonelli, M., Lanave, C., Di Paola, G. (1985) ACNUC - a portable retrieval system for nucleic acid sequence databases: logical and physical designs and usage. Comput. Appl. Biosci., 3:167-172. Gouy, M., Gautier, C., Milleret, F. (1985) System analysis and nucleic acid sequence banks. Biochimie, 67:433-436.

citation("seqinr")

See Also

where.is.this.acc if you have a sequence accession number but you don't know which database to open, query to make a query when a database is opened, connection, socketConnection

Examples

Run this code
# NOT RUN {
  
# }
# NOT RUN {
# Need internet connection
  # Show available databases:  
  choosebank()
  # Show frozen databases:
  choosebank(tag = "TP")
  # Select a database:
  choosebank("emblTP", tag = "TP") 
  # Do something with the database:
  myseq <- gfrag("LMFLCHR36", start = 1, length = 30)
  stopifnot(myseq == "cgcgtgctggcggcaatgaagcgttcgatg")
  # Close the database:
  closebank()
# }

Run the code above in your browser using DataCamp Workspace