#
# #generating an alignment file:
# cat(">Population1_sequence1",
# "TTATAGGTAGCTTCGATATTG",
# ">Population2_sequence1",
# "TTA---GTAGCTTCGAAATTG",
# ">Population3_sequence1",
# "TTA---GTA---TCG---TAG",
# ">Population4_sequence1",
# "TTATAGGTA---TCG---TTG",
# ">Population5_sequence1",
# "TTA------------AAATTG",
# file = "ex1.fas", sep = "\n")
#
# # Reading the alignment directly from file:
# FindHaplo(inputFile="ex1.fas")
#
# # Reading the alignment from an object:
# library(ape)
# example1<-read.dna(file="ex1.fas",format="fasta")
# FindHaplo(align=example1)
#
# #generating a new alignment file with identical sequences wrongly aligned:
# cat(">Pop1_seq1",
# "TTATTCTA--------TAGC",
# ">Pop1_seq2",
# "TTAT----TCTA----TAGC",
# ">Pop1_seq3",
# "TAAT----TCTA------AC",
# file = "ex2.2.fas", sep = "\n")
#
# # Note that seq1 and seq2 are equal, but the alignment is different.
# # However, this function identifies seq1 and seq2 as identical:
# FindHaplo(inputFile="ex2.2.fas")
#
Run the code above in your browser using DataLab