Last chance! 50% off unlimited learning
Sale ends in
Translates Unicode code points in each input string.
stri_trans_char(str, pattern, replacement)Returns a character vector.
character vector
a single character string providing code points to be translated
a single character string giving translated code points
Marek Gagolewski and other contributors
Vectorized over str and with respect to each code point
in pattern and replacement.
If pattern and replacement consist of a different number
of code points, then the extra code points in the longer of the two
are ignored, with a warning.
If code points in a given pattern are not unique, the
last corresponding replacement code point is used.
Time complexity for each string in str is
O(stri_length(str)*stri_length(pattern)).
The official online manual of stringi at https://stringi.gagolewski.com/
Gagolewski M., stringi: Fast and portable character string processing in R, Journal of Statistical Software 103(2), 2022, 1-59, tools:::Rd_expr_doi("10.18637/jss.v103.i02")
Other transform:
stri_trans_general(),
stri_trans_list(),
stri_trans_nfc(),
stri_trans_tolower()
stri_trans_char('id.123', '.', '_')
stri_trans_char('babaab', 'ab', '01')
stri_trans_char('GCUACGGAGCUUCGGAGCUAG', 'ACGT', 'TGCA')
Run the code above in your browser using DataLab