traits.Rmd

traits introduction

library("traits")

BetyDB

Get trait data for Willow (Salix spp.)

(salix <- betydb_search("Salix Vcmax")) #> # A tibble: 14 x 36 #> checked result_type id citation_id site_id treatment_id sitename #> #> 1 1 traits 39217 430 645 1342 "" #> 2 1 traits 39218 430 645 1343 "" #> 3 1 traits 39219 430 645 1344 "" #> 4 1 traits 39220 430 645 1345 "" #> 5 1 traits 25405 51 NA 1 #> 6 1 traits 39213 430 645 1342 "" #> 7 1 traits 39214 430 645 1343 "" #> 8 1 traits 39215 430 645 1344 "" #> 9 1 traits 39216 430 645 1345 "" #> 10 1 traits 39221 430 645 1342 "" #> 11 1 traits 39222 430 645 1343 "" #> 12 1 traits 39223 430 645 1344 "" #> 13 1 traits 39224 430 645 1345 "" #> 14 1 traits 37519 381 602 1220 #> # … with 29 more variables: city , lat , lon , #> # scientificname , commonname , genus , species_id , #> # cultivar_id , author , citation_year , treatment , #> # date , time , raw_date , month , year , #> # dateloc , trait , trait_description , mean , #> # units , n , statname , stat , notes , #> # access_level , cultivar , entity , method_name # equivalent: # (out <- betydb_search("willow"))

Summarise data from the output data.frame

library("dplyr") salix %>% group_by(scientificname, trait) %>% mutate(.mean = as.numeric(mean)) %>% summarise(mean = round(mean(.mean, na.rm = TRUE), 2), min = round(min(.mean, na.rm = TRUE), 2), max = round(max(.mean, na.rm = TRUE), 2), n = length(n)) #> # A tibble: 4 x 6 #> # Groups: scientificname [4] #> scientificname trait mean min max n #> #> 1 Salix Vcmax 65 65 65 1 #> 2 Salix dasyclados Vcmax 46.1 34.3 56.7 4 #> 3 Salix sachalinensis × miyabeana Vcmax 79.3 79.3 79.3 1 #> 4 Salix viminalis Vcmax 43.0 20.0 61.3 8

NCBI sequence data

Get sequences by id

ncbi_byid(ids = "360040093") #> taxon #> 1 Eristalis transversa #> taxonomy #> 1 Eukaryota; Metazoa; Ecdysozoa; Arthropoda; Hexapoda; Insecta; Pterygota; Neoptera; Holometabola; Diptera; Brachycera; Muscomorpha; Syrphoidea; Syrphidae; Eristalinae; Eristalini; Eristalis #> gene_desc #> 1 Eristalis transversa voucher CNC:Diptera:102013 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial #> organelle gi_no acc_no keyword specimen_voucher #> 1 mitochondrion 360040093 JN991986.1 BARCODE CNC:Diptera:102013 #> lat_lon #> 1 38.4623 N 79.2417 W #> country #> 1 USA: Virginia, Reddish Knob Lookout, 14.5km W Briery Branch #> paper_title #> 1 The evolution of imperfect mimicry in hover flies (Diptera: Syrphidae) #> journal first_author uploaded_date length #> 1 Unpublished Penny,H.D. 03-NOV-2012 658 #> sequence #> 1 tactttatattttgtatttggaacatgagcgggtatagtaggaacttcattaagaattttaattcgagctgaattaggtcatccaggtgcattaattggtgatgatcaaatttataatgttattgtaacagctcatgcttttgttataattttttttatagtaatacctattataattggaggatttggaaattgattagtaccacttatattaggagctccagatatagcattccctcgaataaataatataagtttctgattattacctccttctttaactctattattagtaagaagtatagtagaaaatggggctggaacaggatgaacagtttatcctccattatcaagtaatattgcacatggaggagcctcagttgatttagcaattttttcacttcacttatcaggaatatcatctattttaggtgcagtaaattttattacaacagttattaatatacgatcaacaggaattacttatgatcgtatacctttatttgtttgatctgttgctattacagctttattattattattatcattaccagtactagcaggagctattacaatattattaactgatcgaaatttaaatacatcattctttgatccagcaggaggaggagaccctatcctgtaccaacacttattc

Get sequences searching by taxonomic name

out <- ncbi_searcher(taxa = "Umbra limi", seqrange = "1:2000") #> ══ 1 queries ═══════════════ #> ✔ Found: Umbra+limi #> ══ Results ═════════════════ #> #> ● Total: 1 #> ● Found: 1 #> ● Not Found: 0 head(out) #> taxon length #> 1 Umbra limi 761 #> 2 Umbra limi 765 #> 3 Umbra limi 764 #> 4 Umbra limi 743 #> 5 Umbra limi 758 #> 6 Umbra limi 653 #> gene_desc #> 1 Umbra limi voucher NXG2012264 rhodopsin (Rho) gene, partial cds #> 2 Umbra limi voucher NXG201250 rhodopsin (Rho) gene, partial cds #> 3 Umbra limi voucher NXG2012183 rhodopsin (Rho) gene, partial cds #> 4 Umbra limi voucher NXG201252 rhodopsin (Rho) gene, partial cds #> 5 Umbra limi voucher NXG2012231 rhodopsin (Rho) gene, partial cds #> 6 Umbra limi voucher NXG201250 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial #> acc_no gi_no #> 1 KX146134 1049488959 #> 2 KX146015 1049488721 #> 3 KX145969 1049488629 #> 4 KX145777 1049488245 #> 5 KX145759 1049488209 #> 6 KX145415 1049487591

EOL's traitbank trait data

traitbank(query = "MATCH (n:Trait) RETURN n LIMIT 1;") #> $columns #> [1] "n" #> #> $data #> $data[[1]] #> metadata.id metadata.labels #> 1 20280619 Trait #> paged_traverse #> 1 http://10.252.248.44:7474/db/data/node/20280619/paged/traverse/{r} #> outgoing_relationships #> 1 http://10.252.248.44:7474/db/data/node/20280619/relationships/out #> outgoing_typed_relationships #> 1 http://10.252.248.44:7474/db/data/node/20280619/relationships/out/{-list|&|types} #> labels #> 1 http://10.252.248.44:7474/db/data/node/20280619/labels #> create_relationship #> 1 http://10.252.248.44:7474/db/data/node/20280619/relationships #> traverse #> 1 http://10.252.248.44:7474/db/data/node/20280619/traverse/{r} #> all_relationships #> 1 http://10.252.248.44:7474/db/data/node/20280619/relationships/all #> all_typed_relationships #> 1 http://10.252.248.44:7474/db/data/node/20280619/relationships/all/{-list|&|types} #> property #> 1 http://10.252.248.44:7474/db/data/node/20280619/properties/{key} #> self #> 1 http://10.252.248.44:7474/db/data/node/20280619 #> incoming_relationships #> 1 http://10.252.248.44:7474/db/data/node/20280619/relationships/in #> properties #> 1 http://10.252.248.44:7474/db/data/node/20280619/properties #> incoming_typed_relationships #> 1 http://10.252.248.44:7474/db/data/node/20280619/relationships/in/{-list|&|types} #> data.eol_pk data.resource_pk #> 1 R74-PK5014587 110690 #> data.scientific_name #> 1 Adenopodia floribunda (Kleinhoonte) Brenan #> data.source #> 1 http://www.pnas.org/content/114/40/10695 #> data.literal #> 1 http://eol.org/schema/terms/Tropical_and_subtropical_moist_broadleaf_forests

Coral

Get the species list and their ids

coral_species() #> # A tibble: 1,548 x 2 #> name id #> #> 1 Acanthastrea brevis 3 #> 2 Acanthastrea echinata 4 #> 3 Acanthastrea hemprichi 6 #> 4 Acanthastrea ishigakiensis 8 #> 5 Acanthastrea regularis 12 #> 6 Acanthastrea rotundoflora 13 #> 7 Acanthastrea subechinata 14 #> 8 Acropora abrolhosensis 16 #> 9 Acropora abrotanoides 17 #> 10 Acropora aculeus 18 #> # … with 1,538 more rows

Get data by taxon

coral_taxa(80) #> # A tibble: 3,540 x 25 #> observation_id access user_id specie_id specie_name location_id #> #> 1 157133 1 10 80 Acropora h… 1 #> 2 156961 1 14 80 Acropora h… 409 #> 3 5781 1 1 80 Acropora h… 1 #> 4 156610 1 2 80 Acropora h… 500 #> 5 158118 1 10 80 Acropora h… 409 #> 6 119211 1 49 80 Acropora h… 1 #> 7 158211 1 10 80 Acropora h… 413 #> 8 90294 1 15 80 Acropora h… 341 #> 9 90294 1 15 80 Acropora h… 341 #> 10 90294 1 15 80 Acropora h… 341 #> # … with 3,530 more rows, and 19 more variables: location_name , #> # latitude , longitude , resource_id , #> # resource_secondary_id , measurement_id , trait_id , #> # trait_name , standard_id , standard_unit , #> # methodology_id , methodology_name , value , #> # value_type , precision , precision_type , #> # precision_upper , replicates , notes

Get data by trait

coral_traits(105) #> # A tibble: 0 x 25 #> # … with 25 variables: observation_id , access , user_id , #> # specie_id , specie_name , location_id , #> # location_name , latitude , longitude , #> # resource_id , resource_secondary_id , measurement_id , #> # trait_id , trait_name , standard_id , #> # standard_unit , methodology_id , methodology_name , #> # value , value_type , precision , precision_type , #> # precision_upper , replicates , notes

Birdlife International

Habitat data

birdlife_habitat(22721692) #> id Habitat (level 1) Habitat (level 2) Importance #> 1 22721692 Forest Subtropical/Tropical Dry major #> 2 22721692 Forest Subtropical/Tropical Moist Montane major #> 3 22721692 Forest Temperate suitable #> 4 22721692 Shrubland Subtropical/Tropical High Altitude suitable #> Occurrence #> 1 breeding #> 2 non-breeding #> 3 breeding #> 4 breeding

Threats data

birdlife_threats(22721692) #> id threat1 #> 1 22721692 Agriculture & aquaculture #> 2 22721692 Agriculture & aquaculture #> 3 22721692 Biological resource use #> 4 22721692 Climate change & severe weather #> 5 22721692 Climate change & severe weather #> 6 22721692 Climate change & severe weather #> 7 22721692 Invasive and other problematic species, genes & diseases #> 8 22721692 Invasive and other problematic species, genes & diseases #> 9 22721692 Invasive and other problematic species, genes & diseases #> 10 22721692 Invasive and other problematic species, genes & diseases #> 11 22721692 Invasive and other problematic species, genes & diseases #> 12 22721692 Invasive and other problematic species, genes & diseases #> 13 22721692 Natural system modifications #> 14 22721692 Natural system modifications #> 15 22721692 Residential & commercial development #> 16 22721692 Transportation & service corridors #> threat2 #> 1 Annual & perennial non-timber crops - Agro-industry farming #> 2 Annual & perennial non-timber crops - Small-holder farming #> 3 Logging & wood harvesting - Unintentional effects: (subsistence/small scale) [harvest] #> 4 Droughts #> 5 Habitat shifting & alteration #> 6 Storms & flooding #> 7 Invasive non-native/alien species/diseases - Sus scrofa #> 8 Invasive non-native/alien species/diseases - Unspecified species #> 9 Problematic native species/diseases - Dendroctonus frontalis #> 10 Problematic native species/diseases - Odocoileus virginianus #> 11 Problematic native species/diseases - Unspecified species #> 12 Problematic species/disease of unknown origin - Unspecified species #> 13 Fire & fire suppression - Trend Unknown/Unrecorded #> 14 Other ecosystem modifications #> 15 Housing & urban areas #> 16 Roads & railroads #> stresses #> 1 Ecosystem degradation, Ecosystem conversion, Other #> 2 Ecosystem degradation, Ecosystem conversion, Other #> 3 Ecosystem degradation #> 4 Ecosystem degradation #> 5 Ecosystem degradation, Ecosystem conversion #> 6 Ecosystem degradation #> 7 Ecosystem degradation, Ecosystem conversion #> 8 Species mortality #> 9 Ecosystem degradation #> 10 Ecosystem degradation #> 11 Ecosystem degradation, Reduced reproductive success #> 12 Species mortality #> 13 Ecosystem degradation, Ecosystem conversion #> 14 Ecosystem degradation, Ecosystem conversion #> 15 Ecosystem degradation, Ecosystem conversion, Species mortality, Other #> 16 Species mortality #> timing #> 1 Agriculture & aquaculture #> 2 Agriculture & aquaculture #> 3 Biological resource use #> 4 Climate change & severe weather #> 5 Climate change & severe weather #> 6 Climate change & severe weather #> 7 Invasive and other problematic species, genes & diseases #> 8 Invasive and other problematic species, genes & diseases #> 9 Invasive and other problematic species, genes & diseases #> 10 Invasive and other problematic species, genes & diseases #> 11 Invasive and other problematic species, genes & diseases #> 12 Invasive and other problematic species, genes & diseases #> 13 Natural system modifications #> 14 Natural system modifications #> 15 Residential & commercial development #> 16 Transportation & service corridors #> scope #> 1 Annual & perennial non-timber crops - Agro-industry farming #> 2 Annual & perennial non-timber crops - Small-holder farming #> 3 Logging & wood harvesting - Unintentional effects: (subsistence/small scale) [harvest] #> 4 Droughts #> 5 Habitat shifting & alteration #> 6 Storms & flooding #> 7 Invasive non-native/alien species/diseases - Sus scrofa #> 8 Invasive non-native/alien species/diseases - Unspecified species #> 9 Problematic native species/diseases - Dendroctonus frontalis #> 10 Problematic native species/diseases - Odocoileus virginianus #> 11 Problematic native species/diseases - Unspecified species #> 12 Problematic species/disease of unknown origin - Unspecified species #> 13 Fire & fire suppression - Trend Unknown/Unrecorded #> 14 Other ecosystem modifications #> 15 Housing & urban areas #> 16 Roads & railroads #> severity impact #> 1 Ongoing Ongoing #> 2 Ongoing Ongoing #> 3 Ongoing Ongoing #> 4 Ongoing Ongoing #> 5 Future Future #> 6 Ongoing Ongoing #> 7 Ongoing Ongoing #> 8 Ongoing Ongoing #> 9 Ongoing Ongoing #> 10 Ongoing Ongoing #> 11 Ongoing Ongoing #> 12 Ongoing Ongoing #> 13 Ongoing Ongoing #> 14 Future Future #> 15 Ongoing Ongoing #> 16 Ongoing Ongoing