powered by
Obtain tRF ID, type, whether exclusive to tRNA space, and tRNA sources of the tRF with its sequence.
annotate_tRF(sequence)
tRF sequence.
tRF ID, type, whether exclusive to tRNA space, and tRNA sources of the tRF.
Loher P, Telonis AG, Rigoutsos I. Sci Rep (2017) <doi: 10.1038/srep41184>
# NOT RUN { sequence='TCCCTGGTGGTCTAGTGGTTAGGATTCGGC' annotate_tRF(sequence) # }
Run the code above in your browser using DataLab