Data Engineering and BI courses are free this week!
Set of functions for creating and manipulating RNA secondary structure plots from CT files or bracket notations.
JP Bida Maintainer: JP Bida <bida.john@gmail.com
| Package: | RRNA |
| Type: | Package |
| Version: | 1.0 |
| Date: | 2015-07-27 |
| License: | GPL-3 |
### Create a CT file from bracket notation
ct=makeCt("(((...(((...)))...(((...)))...)))","AAAUUUCCCAAAGGGUUUAAAGGGUUUCCCUUU")
coord=ct2coord(ct)
RNAPlot(coord,hl=c("GGGUUU","AAAUUU"),seqcols=c(2,4),labTF=TRUE)
Run the code above in your browser using DataLab