parse_silva_fasta

0th

Percentile

Parse SILVA FASTA release

Parses an SILVA FASTA file that can be found at https://www.arb-silva.de/no_cache/download/archive/release_128/Exports/.

Usage
parse_silva_fasta(file = NULL, input = NULL, include_seqs = TRUE)
Arguments
file

The path to a FASTA file containing sequences to use. Either "input" or "file" must be supplied but not both.

input

(character) One of the following:

A character vector of sequences

See the example below for what this looks like. The parser read_fasta produces output like this.

A list of character vectors

Each vector should have one base per element.

A "DNAbin" object

This is the result of parsers like read.FASTA.

A list of "SeqFastadna" objects

This is the result of parsers like read.fasta.

Either "input" or "file" must be supplied but not both.
include_seqs

(logical of length 1) If TRUE, include sequences in the output object.

Details

The input file has a format like:

 >GCVF01000431.1.2369
Bacteria;Proteobacteria;Gammaproteobacteria;Oceanospiril...
CGUGCACGGUGGAUGCCUUGGCAGCCAGAGGCGAUGAAGGACGUUGUAGCCUGCGAUAAGCUCCGGUUAGGUGGCAAACA
ACCGUUUGACCCGGAGAUCUCCGAAUGGGGCAACCCACCCGUUGUAAGGCGGGUAUCACCGACUGAAUCCAUAGGUCGGU
... 

Value

taxmap

See Also

Other parsers: parse_dada2, parse_edge_list, parse_greengenes, parse_mothur_tax_summary, parse_mothur_taxonomy, parse_newick, parse_phyloseq, parse_phylo, parse_qiime_biom, parse_rdp, parse_ubiome, parse_unite_general

Aliases
  • parse_silva_fasta
Documentation reproduced from package metacoder, version 0.3.3, License: GPL-2 | GPL-3

Community examples

Looks like there are no examples yet.