comp

0th

Percentile

complement a nucleic sequence

Complement a sequence, for instance if the sequence is "a","c","g","t" it returns "t","g","c","a". All other values will return NA.

Keywords
manip
Usage
comp(seq)
Arguments
seq
a vector of chars
Value

  • It returns a vector of character which is the complement of a sequence.

References

� To have an overview of the seqinR's functionnality, please consult this vignette: Charif, D., Lobry, J.R. (2005) SeqinR: a contributed package to the R project for statistical computing devoted to biological sequences retrieval and analysis. Springer Verlag, Biological and Medical Physics/Biomedical Series, in preparation.

Aliases
  • comp
Examples
a=s2c("acgtgctcgtatatatatgccc")
   comp(a)		
   b=s2c("acgtXctcgtatatatatgccc")
   comp(b)
Documentation reproduced from package seqinr, version 1.0-1, License: GPL version 2 or newer

Community examples

Looks like there are no examples yet.