showAnnotatedSeq(x, sel = 1, ann = TRUE, pos = TRUE, start = 1,
end = width(x)[sel], width = NA)## S4 method for signature 'XStringSet'
## annotationMetadata(x, annCharset= ...) <- value
## S4 method for signature 'BioVector'
## annotationMetadata(x, annCharset= ...) <- value
## S3 method for class 'BioVector':
annotationMetadata(x, ...) <- value
## S3 method for class 'XStringSet':
annotationMetadata(x)
## S3 method for class 'BioVector':
annotationMetadata(x)
## S3 method for class 'XStringSet':
annotationCharset(x)
## S3 method for class 'BioVector':
annotationCharset(x)
DNAStringSet
, RNAStringSet
,
AAStringSet
(or as BioVector
)annotationMetadata
: a character vector with the annotation
stringsannotationCharset
: a character vector with the annotation
annotationMetadata
function (see below). It is stored in the
metadata list as named element annotationCharset
and can be stored
along with other metadata assigned to the sequence set. The annotation
strings for the individual sequences are represented as a character vector
and can be assigned to the XStringSet together with the assignment of the
annotation characterset as element related metadata. Element related
metadata is stored in a DataFrame and the columns of this data frame
represent the different types of metadata that can be assigned in parallel.
The column name for the sequence related annotation information is
"annotation". (see Example section for an example of annotation metadata
assignment) Annotation metadata can be assigned together with position
metadata (see positionMetadata
to a sequence set.
Annotation Specific Kernel Processing
The annotation specific kernel variant of a kernel, e.g. the spectrum kernel
appends the annotation characters corresponding to a specific kmer to this
kmer and treats the resulting pattern as one feature - the basic unit for
similarity determination. The full feature space of an annotation specific
spectrum kernel is the cartesian product of the set of all possible sequence
patterns with the set of all possible anntotions patterns. Dependent on the
number of characters in the annotation character set the feature space
increases drastically compared to the normal spectrum kernel. But through
annotation the similarity consideration between two sequences can be split
into independent parts considered separately, e.g. coding/non-coding,
exon/intron, etc... . For amino acid sequences e.g. a heptad annotation
(consisting of a usually periodic pattern of 7 characters (a to g) can be
used as annotation like in prediction of coiled coil structures. (see
reference Mahrenholz, 2011)
The flag annSpec
passed during creation of a kernel object controls
whether annotation information is evaluated by the kernel. (see functions
spectrumKernel, gappyPairKernel, motifKernel
)
In this way sequences with annotation can be evaluated annotation specific
and without annotation through using two different kernel objects. (see
examples below) The annotation specific kernel variant is available for all
kernels in this package except for the mismatch kernel.
annotationMetadata function
With this function annotation metadata can be assigned to sequences defined
as XStringSet (or BioVector). The sequence annotation strings are stored
as element related information and can be retrieved with the method
mcols
. The characters used for anntation are stored as
annotation characterset for the sequence set and can be retrieved
with the method metadata
. For the assignment of annotation
metadata to biological sequences this function should be used instead of the
lower level functions metadata and mcols. The function
annotationMetadata
performs several checks and also takes care
that other metadata or element metadata assigned to the object is kept.
Annotation metadata are deleted if the parameters annCharset
and
annotation
are set to NULL.
showAnnotatedSeq function
This function displays individual sequences aligned with the annotation
string with 50 positions per line. The two header lines show the start
postion for each bock of 10 characters.
Accessor-like methods
The method annotationMetadata<- assigns annotation metadata to a sequence
set. In the assignment also the annotation characterset must be specified.
Annotation characters which are not listed in the characterset are treated
like invalid sequence characters. They interrupt open patterns and lead
to a restart of the pattern search at this position.spectrumKernel
, gappyPairKernel
,
motifKernel
, positionMetadata
,
metadata
, mcols
## create a set of annotated DNA sequences
## instead of user provided sequences in XStringSet format
## for this example a set of DNA sequences is created
x <- DNAStringSet(c("AGACTTAAGGGACCTGGTCACCACGCTCGGTGAGGGGGACGGGGTGT",
"ATAAAGGTTGCAGACATCATGTCCTTTTTGTCCCTAATTATTTCAGC",
"CAGGAATCAGCACAGGCAGGGGCACGGCATCCCAAGACATCTGGGCC",
"GGACATATACCCACCGTTACGTGTCATACAGGATAGTTCCACTGCCC",
"ATAAAGGTTGCAGACATCATGTCCTTTTTGTCCCTAATTATTTCAGC"))
names(x) <- paste("S", 1:length(x), sep="")
## define the character set used in annotation
## the masking character '-' is is not part of the character set
anncs <- "ei"
## annotation strings for each sequence as character vector
## in the third and fourth sample a part of the sequence is masked
annotStrings <- c("eeeeeeeeeeeeiiiiiiiiieeeeeeeeeeeeeeeeiiiiiiiiii",
"eeeeeeeeeiiiiiiiiiiiiiiiiiiieeeeeeeeeeeeeeeeeee",
"---------eeeeeeeeeeeeeeeeiiiiiiiiiiiiiiiiiiiiii",
"eeeeeeeeeeeeeeeeeeeeeeeiiiiiiiiiiiiiiiiiiii----",
"eeeeeeeeeeeeiiiiiiiiiiiiiiiiiiiiiiieeeeeeeeeeee")
## assign metadata to DNAString object
annotationMetadata(x, annCharset=anncs) <- annotStrings
## show annotation
annotationMetadata(x)
annotationCharset(x)
## show sequence 3 aligned with annotation string
showAnnotatedSeq(x, sel=3)
## create annotation specific spectrum kernel
speca <- spectrumKernel(k=3, annSpec=TRUE, normalized=FALSE)
## show details of kernel object
kernelParameters(speca)
## this kernel object can be now be used in a classification or regression
## task in the usual way or you can use the kernel for example to generate
## the kernel matrix for use with another learning method in another R
## package.
kma <- speca(x)
kma[1:5,1:5]
## generate a dense explicit representation for annotation-specific kernel
era <- getExRep(x, speca, sparse=FALSE)
era[1:5,1:8]
## when a standard spectrum kernel is used with annotated
## sequences the anntotation information is not evaluated
spec <- spectrumKernel(k=3, normalized=FALSE)
km <- spec(x)
km[1:5,1:5]
## finally delete annotation metadata if no longer needed
annotationMetadata(x) <- NULL
## show empty metadata
annotationMetadata(x)
annotationCharset(x)
Run the code above in your browser using DataLab